Sequence retrieval

Genome: Erwinia sp. Ejp617
Start position: 2383700
End position: 2383723
Length: 24

DNA sequence
>NC_017445, from 2383700 to 2383723 (24 bp); Erwinia sp. Ejp617 GCTGGCGCTGACGCTGGCGGTGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2383645-2386062	Sequence	EJP617_21740 ybbP Uncharacterized ABC transporter permease ybbP