Sequence retrieval

Genome: Erwinia sp. Ejp617
Start position: 2369035
End position: 2369058
Length: 24

DNA sequence
>NC_017445, from 2369035 to 2369058 (24 bp); Erwinia sp. Ejp617 CAGCACCAGCGCCAGCACCATCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2367851-2369536	Sequence	EJP617_21580 - putative cation:proton antiport protein (Protein is coded in complementary strand; from 2369536 to 2367851)