Sequence retrieval

Genome: Erwinia sp. Ejp617
Start position: 2279647
End position: 2279670
Length: 24

DNA sequence
>NC_017445, from 2279647 to 2279670 (24 bp); Erwinia sp. Ejp617 TCCTGCTCCAGCTGCTGCTGCTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2278450-2281809	Sequence	EJP617_20680 sbcC ATP-dependent dsDNA exonuclease (Protein is coded in complementary strand; from 2281809 to 2278450)