Sequence retrieval

Genome: Erwinia sp. Ejp617
Start position: 2045237
End position: 2045263
Length: 27

DNA sequence
>NC_017445, from 2045237 to 2045263 (27 bp); Erwinia sp. Ejp617 ATTATCTGCATTATCTGCATTATCTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2044698-2045870	Sequence	EJP617_18500 - hypothetical protein (Protein is coded in complementary strand; from 2045870 to 2044698)