Sequence retrieval

Genome: Erwinia sp. Ejp617
Start position: 1826273
End position: 1826296
Length: 24

DNA sequence
>NC_017445, from 1826273 to 1826296 (24 bp); Erwinia sp. Ejp617 TGGTAATGGTGATGGTGACGGTAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1825885-1826865	Sequence	EJP617_16410 csuE type I pilus protein (Protein is coded in complementary strand; from 1826865 to 1825885)