Sequence retrieval

Genome: Erwinia sp. Ejp617
Start position: 1755776
End position: 1755799
Length: 24

DNA sequence
>NC_017445, from 1755776 to 1755799 (24 bp); Erwinia sp. Ejp617 TTCTTCGTCTTCATCTTCGTCTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1754535-1756376	Sequence	EJP617_15700 rpoD RNA polymerase sigma factor RpoD (Protein is coded in complementary strand; from 1756376 to 1754535)