Sequence retrieval

Genome: Erwinia sp. Ejp617
Start position: 1734523
End position: 1734558
Length: 36

DNA sequence
>NC_017445, from 1734523 to 1734558 (36 bp); Erwinia sp. Ejp617 GGCCAGTTCAGGGGCCAGGTCAAGGGCAAGTTCAGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1734413-1734580	Sequence	EJP617_15500 - hypothetical protein (Protein is coded in complementary strand; from 1734580 to 1734413)