Sequence retrieval

Genome: Erwinia sp. Ejp617
Start position: 1230573
End position: 1230599
Length: 27

DNA sequence
>NC_017445, from 1230573 to 1230599 (27 bp); Erwinia sp. Ejp617 TTTCATTATTTTCATTAATTTCATTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1229318-1231141	Sequence	EJP617_11260 yopH Putative tyrosine-protein phosphatase (Protein is coded in complementary strand; from 1231141 to 1229318)