Sequence retrieval

Genome: Erwinia sp. Ejp617
Start position: 1185720
End position: 1185743
Length: 24

DNA sequence
>NC_017445, from 1185720 to 1185743 (24 bp); Erwinia sp. Ejp617 CACCAGCACCAGCGCCAGCAGCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1185280-1186182	Sequence	EJP617_10840 dppC dipeptide transporter (Protein is coded in complementary strand; from 1186182 to 1185280)