Sequence retrieval

Genome: Erwinia sp. Ejp617
Start position: 1106348
End position: 1106371
Length: 24

DNA sequence
>NC_017445, from 1106348 to 1106371 (24 bp); Erwinia sp. Ejp617 GCTCCAGCACCAGCACCAGCGCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1105520-1117042	Sequence	EJP617_10280 fhaB FhaB (Protein is coded in complementary strand; from 1117042 to 1105520)