Sequence retrieval

Genome: Erwinia sp. Ejp617
Start position: 1400160
End position: 1400186
Length: 27

DNA sequence
>NC_017445, from 1400160 to 1400186 (27 bp); Erwinia sp. Ejp617 CGCGTCTTCCGCATCTTCCGCATCTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1400149-1401180	Sequence	EJP617_12720 rbn Ribonuclease BN (Protein is coded in complementary strand; from 1401180 to 1400149)