Sequence retrieval

Genome: Erwinia sp. Ejp617
Start position: 2727241
End position: 2727264
Length: 24

DNA sequence
>NC_017445, from 2727241 to 2727264 (24 bp); Erwinia sp. Ejp617 CTGGAGCGGGAGCTGGTGCTGGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2726826-2727893	Sequence	EJP617_24870 - outer membrane protein A (Protein is coded in complementary strand; from 2727893 to 2726826)