Sequence retrieval

Genome: Chlamydia trachomatis A2497
Start position: 336336
End position: 336359
Length: 24

DNA sequence
>NC_017437, from 336336 to 336359 (24 bp); Chlamydia trachomatis A2497 TTTTTATTTCTTTATTTTTTTAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 336356-339160	Sequence	CTO_0323 - Serine/threonine protein kinase (Protein is coded in complementary strand; from 339160 to 336356)