Sequence retrieval

Genome: Chlamydia trachomatis D-LC
Start position: 334207
End position: 334230
Length: 24

DNA sequence
>NC_017436, from 334207 to 334230 (24 bp); Chlamydia trachomatis D-LC TTTTTATTTCTTTATTTTTTTAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 334227-337031	Sequence	CTDLC_0301 pknD Serine/threonine protein kinase (Protein is coded in complementary strand; from 337031 to 334227)