Sequence retrieval

Genome: Helicobacter pylori F32
Start position: 878658
End position: 878693
Length: 36

DNA sequence
>NC_017366, from 878658 to 878693 (36 bp); Helicobacter pylori F32 TTTAATTCTGTGTTTAATTCTGTGTTTAATTCTGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 877956-879161	Sequence	HPF32_0814 hsdS_2 type I restriction-modification system specificity subunit (Protein is coded in complementary strand; from 879161 to 877956)