Sequence retrieval

Genome: Helicobacter pylori F32
Start position: 823975
End position: 824010
Length: 36

DNA sequence
>NC_017366, from 823975 to 824010 (36 bp); Helicobacter pylori F32 TTTAATTCTGTGTTTAATTCTGTGTTTAATTCTGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 823252-824487	Sequence	HPF32_0757 hsdS-2 type I restriction-modification system specificity subunit (Protein is coded in complementary strand; from 824487 to 823252)