Sequence retrieval

Genome: Helicobacter pylori F32
Start position: 801725
End position: 801748
Length: 24

DNA sequence
>NC_017366, from 801725 to 801748 (24 bp); Helicobacter pylori F32 AACAAAAACAACAAAAAAAACAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 801059-801796	Sequence	HPF32_0740 - hypothetical protein (Protein is coded in complementary strand; from 801796 to 801059)