Sequence retrieval

Genome: Helicobacter pylori F32
Start position: 651684
End position: 651719
Length: 36

DNA sequence
>NC_017366, from 651684 to 651719 (36 bp); Helicobacter pylori F32 ATTTGCGCGATTTTTTGCGCGATTTTTTGCGCGCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 650118-652367	Sequence	HPF32_0599 mutS recombination and DNA strand exchange inhibitor protein (Protein is coded in complementary strand; from 652367 to 650118)