Sequence retrieval

Genome: Helicobacter pylori F32
Start position: 6439
End position: 6462
Length: 24

DNA sequence
>NC_017366, from 6439 to 6462 (24 bp); Helicobacter pylori F32 CTACTACTACCACTACTGCTACTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4999-7152	Sequence	HPF32_0007 hopZ outer membrane protein BabA (Protein is coded in complementary strand; from 7152 to 4999)