Sequence retrieval

Genome: Helicobacter pylori F32
Start position: 545161
End position: 545190
Length: 30

DNA sequence
>NC_017366, from 545161 to 545190 (30 bp); Helicobacter pylori F32 GCTTTTTTTAGCTTCTTCTAACTTTTTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 541445-547453	Sequence	HPF32_0506 cagY cag pathogenicity island protein Y VirB10-like protein (Protein is coded in complementary strand; from 547453 to 541445)