Sequence retrieval

Genome: Helicobacter pylori F32
Start position: 479332
End position: 479367
Length: 36

DNA sequence
>NC_017366, from 479332 to 479367 (36 bp); Helicobacter pylori F32 CATGCAAAGTTTCATGCAAAGTTTCATGCAAAGTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 479334-481208	Sequence	HPF32_0449 ackA/pta fusion protein of phosphotransacetylase and acetate kinase