Sequence retrieval

Genome: Helicobacter pylori F32
Start position: 476639
End position: 476683
Length: 45

DNA sequence
>NC_017366, from 476639 to 476683 (45 bp); Helicobacter pylori F32 TGGGGCTTTTGATCAGAGAGCTTTTGATCAAGGGGTTTTTGTTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 476516-477505	Sequence	HPF32_0447 flgD flagellar basal body rod modification protein (Protein is coded in complementary strand; from 477505 to 476516)