Sequence retrieval

Genome: Helicobacter pylori F32
Start position: 358401
End position: 358454
Length: 54

DNA sequence
>NC_017366, from 358401 to 358454 (54 bp); Helicobacter pylori F32 GGTTTGAGAGATCGCATGTGTTTGAGAGATCGCATGTGTTTGAGAGATCGCATG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 357970-358557	Sequence	HPF32_0348 - hypothetical protein (Protein is coded in complementary strand; from 358557 to 357970)