Sequence retrieval

Genome: Helicobacter pylori F32
Start position: 224905
End position: 224949
Length: 45

DNA sequence
>NC_017366, from 224905 to 224949 (45 bp); Helicobacter pylori F32 TTTTCTTTTGCATGCTCTTTTTTTGCATGCTTTTCTTCTATATGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 223957-225123	Sequence	HPF32_0221 dapE succinyl-diaminopimelate desuccinylase (Protein is coded in complementary strand; from 225123 to 223957)