Sequence retrieval

Genome: Helicobacter pylori F32
Start position: 180055
End position: 180090
Length: 36

DNA sequence
>NC_017366, from 180055 to 180090 (36 bp); Helicobacter pylori F32 CCTCTTTAGGCTCCTCTTTAGTTTCTTCTTTAGCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 179436-180155	Sequence	HPF32_0177 - hypothetical protein (Protein is coded in complementary strand; from 180155 to 179436)