Sequence retrieval

Genome: Helicobacter pylori F32
Start position: 1448094
End position: 1448129
Length: 36

DNA sequence
>NC_017366, from 1448094 to 1448129 (36 bp); Helicobacter pylori F32 ACACTCGCAATAAAACTCGCAATAAAAATCGCAATA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1448052-1449182	Sequence	HPF32_1373 - hypothetical protein (Protein is coded in complementary strand; from 1449182 to 1448052)