Sequence retrieval

Genome: Helicobacter pylori F32
Start position: 1446975
End position: 1447025
Length: 51

DNA sequence
>NC_017366, from 1446975 to 1447025 (51 bp); Helicobacter pylori F32 TGCTTTTCTTTCTTCATGGCTTTTCTTTTTTCATGATTTTTCTTTCTTCAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 1446261-1446992	Sequence	HPF32_1370 ubiE ubiquinone/menaquinone biosynthesis methyltransferase (Protein is coded in complementary strand; from 1446992 to 1446261)