Sequence retrieval

Genome: Helicobacter pylori F32
Start position: 1103610
End position: 1103636
Length: 27

DNA sequence
>NC_017366, from 1103610 to 1103636 (27 bp); Helicobacter pylori F32 TTTTCTAAATTTTCTAAGGTTTCTAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1103514-1105340	Sequence	HPF32_1036 edd phosphogluconate dehydratase (Protein is coded in complementary strand; from 1105340 to 1103514)