Sequence retrieval

Genome: Sinorhizobium meliloti BL225C
Start position: 251716
End position: 251745
Length: 30

DNA sequence
>NC_017322, from 251716 to 251745 (30 bp); Sinorhizobium meliloti BL225C GATGCCGGTGCCGATGCTGATCCCGATGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 251642-251896	Sequence	SinmeB_0231 - transglycosylase (Protein is coded in complementary strand; from 251896 to 251642)