Sequence retrieval

Genome: Sinorhizobium meliloti BL225C
Start position: 2823296
End position: 2823322
Length: 27

DNA sequence
>NC_017322, from 2823296 to 2823322 (27 bp); Sinorhizobium meliloti BL225C ACGAGCACGATGAGCACGACGACCACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2823230-2823895	Sequence	SinmeB_2718 - ABC transporter (Protein is coded in complementary strand; from 2823895 to 2823230)