Sequence retrieval

Genome: Sinorhizobium meliloti BL225C
Start position: 739124
End position: 739147
Length: 24

DNA sequence
>NC_017322, from 739124 to 739147 (24 bp); Sinorhizobium meliloti BL225C GACGATGGCGATGACGACGACGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 738171-739172	Sequence	SinmeB_0700 - glycerophosphoryl diester phosphodiesterase (Protein is coded in complementary strand; from 739172 to 738171)