Sequence retrieval

Genome: Sinorhizobium meliloti BL225C
Start position: 3559086
End position: 3559109
Length: 24

DNA sequence
>NC_017322, from 3559086 to 3559109 (24 bp); Sinorhizobium meliloti BL225C GTCGTCGTCATCGTCTTCGTCGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3559042-3559431	Sequence	SinmeB_3356 - hypothetical protein (Protein is coded in complementary strand; from 3559431 to 3559042)