Sequence retrieval

Genome: Sinorhizobium meliloti BL225C
Start position: 2216735
End position: 2216758
Length: 24

DNA sequence
>NC_017322, from 2216735 to 2216758 (24 bp); Sinorhizobium meliloti BL225C CTCGTCGTCGTCCTCCTCCTCTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2215461-2217515	Sequence	SinmeB_2142 - RNA polymerase sigma-70 subunit RpoD (Protein is coded in complementary strand; from 2217515 to 2215461)