Sequence retrieval

Genome: Sinorhizobium meliloti BL225C
Start position: 2041650
End position: 2041673
Length: 24

DNA sequence
>NC_017322, from 2041650 to 2041673 (24 bp); Sinorhizobium meliloti BL225C CTCCGCCTTCGCCTTCGCCTCCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2041501-2043654	Sequence	SinmeB_1988 - DNA ligase (Protein is coded in complementary strand; from 2043654 to 2041501)