Sequence retrieval

Genome: Sinorhizobium meliloti BL225C
Start position: 1653352
End position: 1653375
Length: 24

DNA sequence
>NC_017322, from 1653352 to 1653375 (24 bp); Sinorhizobium meliloti BL225C CGAGCGCGAGCGCGCGCGCAAGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1653063-1653872	Sequence	SinmeB_1582 - Fe(3+)-transporting ATPase (Protein is coded in complementary strand; from 1653872 to 1653063)