Sequence retrieval

Genome: Clostridium acetobutylicum EA 2018
Start position: 456522
End position: 456545
Length: 24

DNA sequence
>NC_017295, from 456522 to 456545 (24 bp); Clostridium acetobutylicum EA 2018 AGCAGTAGCAGTAGCGGTAGCAGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 456193-456648	Sequence	CEA_G0402 - Peptodoglycan-binding domain protein (Protein is coded in complementary strand; from 456648 to 456193)