Sequence retrieval

Genome: Clostridium acetobutylicum EA 2018
Start position: 3938614
End position: 3938637
Length: 24

DNA sequence
>NC_017295, from 3938614 to 3938637 (24 bp); Clostridium acetobutylicum EA 2018 TTTTTCTTGTTCTTTTTATTCTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3938611-3939375	Sequence	CEA_G3743 - putative inner membrane protein translocase component YidC (Protein is coded in complementary strand; from 3939375 to 3938611)