Sequence retrieval

Genome: Clostridium acetobutylicum EA 2018
Start position: 3708569
End position: 3708592
Length: 24

DNA sequence
>NC_017295, from 3708569 to 3708592 (24 bp); Clostridium acetobutylicum EA 2018 ATAATTATAACTGTAATTATTATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3706928-3708649	Sequence	CEA_G3515 - Membrane associated methyl-accepting chemotaxis protein with HAMP domain (Protein is coded in complementary strand; from 3708649 to 3706928)