Sequence retrieval

Genome: Clostridium acetobutylicum EA 2018
Start position: 3478179
End position: 3478205
Length: 27

DNA sequence
>NC_017295, from 3478179 to 3478205 (27 bp); Clostridium acetobutylicum EA 2018 TCTTGCTACTGTTGCTACTCTTGCTAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3478102-3479136	Sequence	CEA_G3312 - membrane protein (Protein is coded in complementary strand; from 3479136 to 3478102)