Sequence retrieval

Genome: Clostridium acetobutylicum EA 2018
Start position: 3472952
End position: 3472996
Length: 45

DNA sequence
>NC_017295, from 3472952 to 3472996 (45 bp); Clostridium acetobutylicum EA 2018 GTAACCTTCTTTTTCAAAGCCTTCTTTTTCAAAGCCTTCTTTTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3472797-3473696	Sequence	CEA_G3307 - hypothetical protein (Protein is coded in complementary strand; from 3473696 to 3472797)