Sequence retrieval

Genome: Clostridium acetobutylicum EA 2018
Start position: 3363754
End position: 3363788
Length: 35

DNA sequence
>NC_017295, from 3363754 to 3363788 (35 bp); Clostridium acetobutylicum EA 2018 CTTTTTTATTTTTTCTTTTCTCTTTCTTCTTTTTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3361713-3365228	Sequence	CEA_G3220 mfd Transcription-repair coupling factor, MFD (superfamily II helicase ) (Protein is coded in complementary strand; from 3365228 to 3361713)