Sequence retrieval

Genome: Clostridium acetobutylicum EA 2018
Start position: 3350707
End position: 3350730
Length: 24

DNA sequence
>NC_017295, from 3350707 to 3350730 (24 bp); Clostridium acetobutylicum EA 2018 TCTTCATCTTTATCTGCAGCTTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3349525-3350910	Sequence	CEA_G3208 - ATPase of the PP-loop superamily (Protein is coded in complementary strand; from 3350910 to 3349525)