Sequence retrieval

Genome: Clostridium acetobutylicum EA 2018
Start position: 3282468
End position: 3282494
Length: 27

DNA sequence
>NC_017295, from 3282468 to 3282494 (27 bp); Clostridium acetobutylicum EA 2018 CAGCTGCTGCACCTGCTGCACCTGCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3282248-3282619	Sequence	CEA_G3148 rplL 50S ribosomal protein L7/L12 (Protein is coded in complementary strand; from 3282619 to 3282248)