Sequence retrieval

Genome: Clostridium acetobutylicum EA 2018
Start position: 3191488
End position: 3191511
Length: 24

DNA sequence
>NC_017295, from 3191488 to 3191511 (24 bp); Clostridium acetobutylicum EA 2018 TGTTTATTTTTATATTTATTTTTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3191058-3192071	Sequence	CEA_G3048 - O-actetyl transferase related protein (Protein is coded in complementary strand; from 3192071 to 3191058)