Sequence retrieval

Genome: Clostridium acetobutylicum EA 2018
Start position: 3180865
End position: 3180894
Length: 30

DNA sequence
>NC_017295, from 3180865 to 3180894 (30 bp); Clostridium acetobutylicum EA 2018 GCTTTTGAAATCCTTTGAAAACTTTTGAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3178637-3182692	Sequence	CEA_G3042 - Superfamily I DNA helicase (Protein is coded in complementary strand; from 3182692 to 3178637)