Sequence retrieval

Genome: Clostridium acetobutylicum EA 2018
Start position: 3117359
End position: 3117382
Length: 24

DNA sequence
>NC_017295, from 3117359 to 3117382 (24 bp); Clostridium acetobutylicum EA 2018 CATCTATATCTACATCTACATCTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3115642-3118089	Sequence	CEA_G2987 - Mannose-1-phosphate guanyltransferase (pyrophosphorylase domain and phosphomannomutase domain) (Protein is coded in complementary strand; from 3118089 to 3115642)