Sequence retrieval

Genome: Clostridium acetobutylicum EA 2018
Start position: 3028195
End position: 3028219
Length: 25

DNA sequence
>NC_017295, from 3028195 to 3028219 (25 bp); Clostridium acetobutylicum EA 2018 TTTCTTTTATTATCTCTTCTTTACT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3027645-3028676	Sequence	CEA_G2902 ddlA D-alanine--D-alanine ligase (Protein is coded in complementary strand; from 3028676 to 3027645)