Sequence retrieval

Genome: Clostridium acetobutylicum EA 2018
Start position: 2986152
End position: 2986175
Length: 24

DNA sequence
>NC_017295, from 2986152 to 2986175 (24 bp); Clostridium acetobutylicum EA 2018 ATTTCAACTTCACTTTCAATTTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2985354-2986361	Sequence	CEA_G2860 - hypothetical protein (Protein is coded in complementary strand; from 2986361 to 2985354)