Sequence retrieval

Genome: Clostridium acetobutylicum EA 2018
Start position: 2734587
End position: 2734610
Length: 24

DNA sequence
>NC_017295, from 2734587 to 2734610 (24 bp); Clostridium acetobutylicum EA 2018 TTCTTTTTCTTCTTATTTTTCTTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2733863-2734675	Sequence	CEA_G2634 - membrane protein (Protein is coded in complementary strand; from 2734675 to 2733863)