Sequence retrieval

Genome: Clostridium acetobutylicum EA 2018
Start position: 2556407
End position: 2556436
Length: 30

DNA sequence
>NC_017295, from 2556407 to 2556436 (30 bp); Clostridium acetobutylicum EA 2018 ATAGCAATAAATAAAAATAAATAGAAATAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2556173-2556973	Sequence	CEA_G2454 - membrane protein (Protein is coded in complementary strand; from 2556973 to 2556173)